Psilocybe stametsii Dentinger & Furci, sp. nov.

A new Psilocybe species discovered in Ecuador

Basidiospores in 5% KOH, brightfield, 400x. [Photo by Bryn Dentinger]

Basidiospores in 5% KOH, DIC; arbitrarily magnified from 1000x. [Photo by Bryn Dentinger]

Hymenium with emergent utriform cystidium in 5% KOH, DIC, 1000x. [Photo by Bryn Dentinger]

Hymenium with emergent utriform cystidium in 5% KOH, DIC, 1000x. [Photo by Bryn Dentinger]

Hymenium with emergent basidia with attached basidiospores and cystidia in 5% KOH, DIC, 1000x. [Photo by Bryn Dentinger]

Hymenium with emergent four-sterigmate 5% KOH, DIC, 1000x. [Photo by Bryn Dentinger]

FFCL1932, holotype. [Photo by Giuliana Furci]

FFCL1932, holotype. [Photo by Giuliana Furci]

FFCL1932, holotype. [Photo by Giuliana Furci]

K(M)20614, paratype. [Photo by Bryn Dentinger]

K(M)20614, paratype. [Photo by Bryn Dentinger]

Phylonogy (ITS)

Sequences (ITS)

FFCL1932 (GenBank accession: OQ359123):

CATTATTGATGAACTTGGCTTGGTTGTGCTGGTCCTCTCGAGGACATGTGCATGCCTTGTC

ATCTTTATCTATCCACCTGTGAACCCTTTGAGACTTGGCTATAGTGAATGGAGAGCATGCT

CTCTTTGAAGCTATACCAGGCCTATGTTTTCATATACCCCAAAGAATGTAATAGAATGTATT

GTATGGCCTCGTGCCTATAAATCAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCA

TCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCAT

CGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTG

TCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTTTCTTTT

GCTGRCTTAGGTYGGCTCCCCTCAAATGCATTAGCCGGTGCCCYGTGGAACCGTCTATTG

GTGTGATAATTATCTATGCTATTAGACATCTGCATGAATGGGATTGTGCTGCTTCTAACCGT

CCTTTGGACATATAATGACAATTTGACCT

K(M)20614 (GenBank accession OQ359124):

CATTATTGAATGAACTTGGCTTGGTTGTGCTGGTCCTCTCGAGGACATGTGCATGCCTTGT

CATCTTTATCTATCCACCTGTGAACCCTTTGTAGACTTGGCTATAGTGAATGGAGAGCATG

CTCTCTTTGAAGCTATACCAGGCCTATGTTTTCATATACCCCAAAGAATGTAATAGAATGTA

TTGTATGGCCTCGTGCCTATAAATCAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCG

CATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATC

ATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGT

GTCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTTTCTT

TTGCTGGCTTAGGTYGGCTCCCCTCAAATGCATTAGCYGGTGCCCCGTGGAACCGTCTAT

TGGTGTGATAATTATCTACACTATTAGACATCTGCATGAATGGGATTGTGCTGCTTCTAACC

GTCCTTTGGACATATAATGACAATTTGACCT

Acknowledgements

Authors would like to thank: Thomas Jenkinson, Tobias Policha, Bitty Roy, Jesse McAlpine, Martín Obando, César Rodríguez-Garavito, Ramiro Ávila Santamaría, Cosmo Sheldrake, Robert Macfarlane, Dylan Stirewalt, Claudia Narváez and Agustin Grijalva Jiménez who assisted in the collection of the specimens, Izzy Galland who extracted the DNA from the holotype and generated the ITS barcode from it, Alexander Bradshaw for providing ITS sequences to compare with, Paul Kirk for help in preparing the e-publication, as well as Cristian Moreno and José DeCoux for logistical support. Funding support for Dentinger was provided by the National Geographic Society (No. 8317-07 to B.A. Roy and B.T.M. Dentinger) and the National Science Foundation (DEB-0841613 to B.A. Roy and B.T.M. Dentinger).

E-publication

Click here to see the full publication of this species*.

*Note: the spore dimensions in the e-pub were in error, the correct dimensions are:

l (µm) w (µm)
5.66 4.23
5.20 4.18
5.74 4.06
5.45 4.05
5.67 3.83
5.78 4.10
5.48 4.00
5.36 4.41
5.22 4.42
5.72 4.13

Min (µm): 5.20, 3.83

Max (µm): 5.78, 4.42

Mean (µm): 5.53, 4.14

Sequences (ITS)

FFCL1932 (GenBank accession: OQ359123):

CATTATTGATGAACTTGGCTTGGTTGTGCTGGTCCTCTCGAGGACAT

GTGCATGCCTTGTCATCTTTATCTATCCACCTGTGAACCCTTTGAGAC

TTGGCTATAGTGAATGGAGAGCATGCTCTCTTTGAAGCTATACCAGG

CCTATGTTTTCATATACCCCAAAGAATGTAATAGAATGTATTGTATGG

CCTCGTGCCTATAAATCAAATACAACTTTCAGCAACGGATCTCTTGG

CTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGA

ATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCT

CCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTC

AACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTTTCTT

TTGCTGRCTTAGGTYGGCTCCCCTCAAATGCATTAGCCGGTGCCCYG

TGGAACCGTCTATTGGTGTGATAATTATCTATGCTATTAGACATCTGC

ATGAATGGGATTGTGCTGCTTCTAACCGTCCTTTGGACATATAATGA

CAATTTGACCT

K(M)20614 (GenBank accession OQ359124):

CATTATTGAATGAACTTGGCTTGGTTGTGCTGGTCCTCTCGAGGACA

TGTGCATGCCTTGTCATCTTTATCTATCCACCTGTGAACCCTTTGTAG

ACTTGGCTATAGTGAATGGAGAGCATGCTCTCTTTGAAGCTATACCA

GGCCTATGTTTTCATATACCCCAAAGAATGTAATAGAATGTATTGTAT

GGCCTCGTGCCTATAAATCAAATACAACTTTCAGCAACGGATCTCTT

GGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGT

GAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCG

CTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTC

TCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTTTC

TTTTGCTGGCTTAGGTYGGCTCCCCTCAAATGCATTAGCYGGTGCCC

CGTGGAACCGTCTATTGGTGTGATAATTATCTACACTATTAGACATCT

GCATGAATGGGATTGTGCTGCTTCTAACCGTCCTTTGGACATATAAT

GACAATTTGACCT

Acknowledgem-ents

Authors would like to thank: Thomas Jenkinson, Tobias Policha, Bitty Roy, Jesse McAlpine, Martín Obando, César Rodríguez-Garavito, Ramiro Ávila Santamaría, Cosmo Sheldrake, Robert Macfarlane, Dylan Stirewalt, Claudia Narváez and Agustin Grijalva Jiménez who assisted in the collection of the specimens, Izzy Galland who extracted the DNA from the holotype and generated the ITS barcode from it, Alexander Bradshaw for providing ITS sequences to compare with, Paul Kirk for help in preparing the e-publication, as well as Cristian Moreno, Rosa Batallas, and José DeCoux for logistical support. Funding support for Dentinger was provided by the National Geographic Society (No. 8317-07 to B.A. Roy and B.T.M. Dentinger) and the National Science Foundation (DEB-0841613 to B.A. Roy and B.T.M. Dentinger).

E-publication

Click here to see the full publication of this specie.

Sequences (ITS)

FFCL1932 (GenBank accession: OQ359123):

CATTATTGATGAACTTGGCTTGGTTGT

GCTGGTCCTCTCGAGGACATGTGCAT

GCCTTGTCATCTTTATCTATCCACCTGT

GAACCCTTTGAGACTTGGCTATAGTG

AATGGAGAGCATGCTCTCTTTGAAGC

TATACCAGGCCTATGTTTTCATATACCC

CAAAGAATGTAATAGAATGTATTGTAT

GGCCTCGTGCCTATAAATCAAATACAA

CTTTCAGCAACGGATCTCTTGGCTCTC

GCATCGATGAAGAACGCAGCGAAATG

CGATAAGTAATGTGAATTGCAGAATTC

AGTGAATCATCGAATCTTTGAACGCAC

CTTGCGCTCCTTGGTATTCCGAGGAG

CATGCCTGTTTGAGTGTCATTAAATTC

TCAACCTTACCAGCTTTTGCTGATAAT

GGCTTGGATGTGGGGGTTTCTTTTGC

TGRCTTAGGTYGGCTCCCCTCAAATG

CATTAGCCGGTGCCCYGTGGAACCGT

CTATTGGTGTGATAATTATCTATGCTAT

TAGACATCTGCATGAATGGGATTGTGC

TGCTTCTAACCGTCCTTTGGACATATA

ATGACAATTTGACCT

K(M)20614 (GenBank accession OQ359124):

CATTATTGAATGAACTTGGCTTGGTTG

TGCTGGTCCTCTCGAGGACATGTGCA

TGCCTTGTCATCTTTATCTATCCACCTG

TGAACCCTTTGTAGACTTGGCTATAGT

GAATGGAGAGCATGCTCTCTTTGAAG

CTATACCAGGCCTATGTTTTCATATACC

CCAAAGAATGTAATAGAATGTATTGTA

TGGCCTCGTGCCTATAAATCAAATACA

ACTTTCAGCAACGGATCTCTTGGCTCT

CGCATCGATGAAGAACGCAGCGAAAT

GCGATAAGTAATGTGAATTGCAGAATT

CAGTGAATCATCGAATCTTTGAACGCA

CCTTGCGCTCCTTGGTATTCCGAGGA

GCATGCCTGTTTGAGTGTCATTAAATT

CTCAACCTTACCAGCTTTTGCTGATAA

TGGCTTGGATGTGGGGGTTTCTTTTG

CTGGCTTAGGTYGGCTCCCCTCAAAT

GCATTAGCYGGTGCCCCGTGGAACCG

TCTATTGGTGTGATAATTATCTACACTA

TTAGACATCTGCATGAATGGGATTGTG

CTGCTTCTAACCGTCCTTTGGACATAT

AATGACAATTTGACCT

Acknowledgem-ents

Authors would like to thank: Thomas Jenkinson, Tobias Policha, Bitty Roy, Jesse McAlpine, Martín Obando, César Rodríguez-Garavito, Ramiro Ávila Santamaría, Cosmo Sheldrake, Robert Macfarlane, Dylan Stirewalt, Claudia Narváez and Agustin Grijalva Jiménez who assisted in the collection of the specimens, Izzy Galland who extracted the DNA from the holotype and generated the ITS barcode from it, Alexander Bradshaw for providing ITS sequences to compare with, Paul Kirk for help in preparing the e-publication, as well as Cristian Moreno, Rosa Batallas, and José DeCoux for logistical support. Funding support for Dentinger was provided by the National Geographic Society (No. 8317-07 to B.A. Roy and B.T.M. Dentinger) and the National Science Foundation (DEB-0841613 to B.A. Roy and B.T.M. Dentinger).

E-publication

Click here to see the full publication of this specie.